ID: 968688979_968688981

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 968688979 968688981
Species Human (GRCh38) Human (GRCh38)
Location 4:1980313-1980335 4:1980336-1980358
Sequence CCTGAGAAGGGGGCACCATGTGT GCCTTTGCCCACGTGTCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 14, 4: 152} {0: 1, 1: 0, 2: 1, 3: 8, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!