ID: 968692284_968692289

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 968692284 968692289
Species Human (GRCh38) Human (GRCh38)
Location 4:1998740-1998762 4:1998762-1998784
Sequence CCAGAACTTCCTCAACCTAGAGA ACAGGCCAACATGCAAATTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 79, 4: 201} {0: 6, 1: 157, 2: 1424, 3: 3948, 4: 3877}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!