ID: 968695652_968695658

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 968695652 968695658
Species Human (GRCh38) Human (GRCh38)
Location 4:2024928-2024950 4:2024957-2024979
Sequence CCCTGGATCAGGGTGATTGGGAG CAGGATAAACAGTGGCAGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 168} {0: 1, 1: 3, 2: 1, 3: 29, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!