ID: 968703764_968703772

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 968703764 968703772
Species Human (GRCh38) Human (GRCh38)
Location 4:2068967-2068989 4:2068988-2069010
Sequence CCCCCAGGGTGGGGGCGAGCGAG AGTTCTGAGGAGAGGGGCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 193} {0: 1, 1: 0, 2: 3, 3: 58, 4: 544}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!