ID: 968703764_968703778

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 968703764 968703778
Species Human (GRCh38) Human (GRCh38)
Location 4:2068967-2068989 4:2068997-2069019
Sequence CCCCCAGGGTGGGGGCGAGCGAG GAGAGGGGCTGCGGGGGCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 193} {0: 1, 1: 1, 2: 9, 3: 98, 4: 930}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!