ID: 968703764_968703781

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 968703764 968703781
Species Human (GRCh38) Human (GRCh38)
Location 4:2068967-2068989 4:2069002-2069024
Sequence CCCCCAGGGTGGGGGCGAGCGAG GGGCTGCGGGGGCCGGGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 193} {0: 1, 1: 0, 2: 21, 3: 195, 4: 1660}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!