ID: 968710034_968710041

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 968710034 968710041
Species Human (GRCh38) Human (GRCh38)
Location 4:2107855-2107877 4:2107905-2107927
Sequence CCATAACAGCCACATATTGCCAA TCTTGCCATAAGCCAGGCACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 31, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!