ID: 968726590_968726597

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 968726590 968726597
Species Human (GRCh38) Human (GRCh38)
Location 4:2250747-2250769 4:2250770-2250792
Sequence CCAGCCCATTTCTCCCTTTTCTG GAAGCAGAAGCTCTAGGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 84, 4: 1188} {0: 1, 1: 0, 2: 4, 3: 37, 4: 388}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!