ID: 968727353_968727368

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 968727353 968727368
Species Human (GRCh38) Human (GRCh38)
Location 4:2253943-2253965 4:2253988-2254010
Sequence CCTGCCGCCCCCCACCCCAGGAA CGTGCTCTCTCTGCTCAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 137, 4: 1905} {0: 1, 1: 0, 2: 0, 3: 12, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!