ID: 968727354_968727367

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 968727354 968727367
Species Human (GRCh38) Human (GRCh38)
Location 4:2253947-2253969 4:2253985-2254007
Sequence CCGCCCCCCACCCCAGGAACTGT AAGCGTGCTCTCTCTGCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 15, 3: 128, 4: 934} {0: 1, 1: 0, 2: 0, 3: 10, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!