ID: 968727355_968727371

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 968727355 968727371
Species Human (GRCh38) Human (GRCh38)
Location 4:2253950-2253972 4:2254003-2254025
Sequence CCCCCCACCCCAGGAACTGTGTA CAGGGAGGGGTCCTTTCCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 330} {0: 1, 1: 0, 2: 6, 3: 49, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!