ID: 968746464_968746475

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 968746464 968746475
Species Human (GRCh38) Human (GRCh38)
Location 4:2362992-2363014 4:2363031-2363053
Sequence CCATCCCCGTGGTCCCCTCAACC GTCCCCAGCACAGCCTGACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 295} {0: 1, 1: 0, 2: 3, 3: 28, 4: 312}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!