ID: 968746616_968746625

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 968746616 968746625
Species Human (GRCh38) Human (GRCh38)
Location 4:2363817-2363839 4:2363841-2363863
Sequence CCCACCACCCCAGAGGAGGTAAG GGCTGTTCCCCAATTTACAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 169} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!