ID: 968754174_968754178

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 968754174 968754178
Species Human (GRCh38) Human (GRCh38)
Location 4:2406492-2406514 4:2406530-2406552
Sequence CCCTCCCTGTGGGGAAACATGCT GCGCCGTGCTTACCTGATACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 166} {0: 1, 1: 0, 2: 0, 3: 0, 4: 15}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!