ID: 968755886_968755892

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 968755886 968755892
Species Human (GRCh38) Human (GRCh38)
Location 4:2416602-2416624 4:2416622-2416644
Sequence CCCGGCAGAGGCACATGGGGGCA GCAGCAGGCAGGACCGAGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 287} {0: 1, 1: 0, 2: 1, 3: 43, 4: 370}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!