ID: 968756084_968756091

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 968756084 968756091
Species Human (GRCh38) Human (GRCh38)
Location 4:2417353-2417375 4:2417371-2417393
Sequence CCGGCCCTGCTCCGGCTGCAGCG CAGCGGGCACGAGCCCCAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 371} {0: 1, 1: 0, 2: 3, 3: 19, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!