ID: 968756137_968756142

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 968756137 968756142
Species Human (GRCh38) Human (GRCh38)
Location 4:2417524-2417546 4:2417543-2417565
Sequence CCGAGGCTGCTGGCCACGGGCGC GCGCGCTCGCCCCAAGGGCCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!