ID: 968756413_968756428

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 968756413 968756428
Species Human (GRCh38) Human (GRCh38)
Location 4:2418428-2418450 4:2418476-2418498
Sequence CCCGCGCTGTCGCAGGGAGGCTG GGGCGGCGGGCAGGTGCGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 230} {0: 1, 1: 1, 2: 9, 3: 59, 4: 600}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!