ID: 968757862_968757868

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 968757862 968757868
Species Human (GRCh38) Human (GRCh38)
Location 4:2426151-2426173 4:2426179-2426201
Sequence CCAGCTTCGGTCTGTGGTGATGG ACCTGATGGTGAACTCACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 151} {0: 1, 1: 0, 2: 0, 3: 9, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!