ID: 968764554_968764559

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 968764554 968764559
Species Human (GRCh38) Human (GRCh38)
Location 4:2461479-2461501 4:2461510-2461532
Sequence CCGCTGCTGGTGCTGTACAGGGC TGCCCACCAGCTCCCCAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 264} {0: 1, 1: 0, 2: 3, 3: 28, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!