|
Left Crispr |
Right Crispr |
Crispr ID |
968791687 |
968791692 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:2669068-2669090
|
4:2669090-2669112
|
Sequence |
CCTGACTTCAGGTGACCTACCCG |
GCCTTGGCCTCCCAAAGTGCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 63, 2: 2263, 3: 28702, 4: 93928} |
{0: 52775, 1: 164492, 2: 216668, 3: 175886, 4: 111238} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|