|
Left Crispr |
Right Crispr |
| Crispr ID |
968791687 |
968791699 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:2669068-2669090
|
4:2669118-2669140
|
| Sequence |
CCTGACTTCAGGTGACCTACCCG |
CAGGCATGAGCTACCACGCCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 63, 2: 2263, 3: 28702, 4: 93928} |
{0: 187, 1: 7167, 2: 46335, 3: 129270, 4: 190929} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|