ID: 968794205_968794211

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 968794205 968794211
Species Human (GRCh38) Human (GRCh38)
Location 4:2691525-2691547 4:2691540-2691562
Sequence CCCAGCCTAGGGTACAGCCCCTG AGCCCCTGGCTGTCACTTAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 201} {0: 1, 1: 0, 2: 1, 3: 6, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!