|
Left Crispr |
Right Crispr |
Crispr ID |
968798317 |
968798327 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:2724570-2724592
|
4:2724619-2724641
|
Sequence |
CCAGGCACAGCGTTCACACCTTG |
GTGGAGGATCACTTGAGCCCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 0, 2: 0, 3: 10, 4: 134} |
{0: 71, 1: 1110, 2: 19428, 3: 58109, 4: 146148} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|