ID: 968812613_968812625

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 968812613 968812625
Species Human (GRCh38) Human (GRCh38)
Location 4:2806748-2806770 4:2806775-2806797
Sequence CCCCCGGGCAGTCCCGACTCCCA CATCTCAAGAACCTTTCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 124} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!