ID: 968830544_968830548

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 968830544 968830548
Species Human (GRCh38) Human (GRCh38)
Location 4:2931239-2931261 4:2931256-2931278
Sequence CCACGGAGGACAGGCAGGGCACC GGCACCACAACGGCGGCGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 224} {0: 1, 1: 0, 2: 0, 3: 8, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!