ID: 968839032_968839035

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 968839032 968839035
Species Human (GRCh38) Human (GRCh38)
Location 4:2987602-2987624 4:2987643-2987665
Sequence CCTGTTTGAGTCCGTGCTTTCAC CAGAAGCAGAATTGTTGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 64, 4: 167} {0: 1, 1: 0, 2: 4, 3: 18, 4: 299}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!