ID: 968839033_968839034

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 968839033 968839034
Species Human (GRCh38) Human (GRCh38)
Location 4:2987613-2987635 4:2987638-2987660
Sequence CCGTGCTTTCACTTGTTTTGTGT GTACTCAGAAGCAGAATTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 67, 3: 407, 4: 1475} {0: 1, 1: 0, 2: 12, 3: 93, 4: 670}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!