ID: 968846089_968846100

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 968846089 968846100
Species Human (GRCh38) Human (GRCh38)
Location 4:3042254-3042276 4:3042298-3042320
Sequence CCTTCTTTGTACGAGGGGAAGGG ACTTGGGGTCTTTATTCTTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 27, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!