ID: 968850601_968850617

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 968850601 968850617
Species Human (GRCh38) Human (GRCh38)
Location 4:3075083-3075105 4:3075126-3075148
Sequence CCGACCGTGAGTTTGGGCCCGCT GTCCCAGGCTACGGCGGGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 31} {0: 1, 1: 0, 2: 3, 3: 11, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!