|
Left Crispr |
Right Crispr |
| Crispr ID |
968852962 |
968852966 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:3095483-3095505
|
4:3095498-3095520
|
| Sequence |
CCAGCCTTGGCTCGGCATCAGAG |
CATCAGAGGGAGACTGTGCGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 36, 1: 231, 2: 618, 3: 475, 4: 409} |
{0: 1, 1: 1, 2: 8, 3: 104, 4: 201} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|