ID: 968866044_968866052

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 968866044 968866052
Species Human (GRCh38) Human (GRCh38)
Location 4:3212585-3212607 4:3212604-3212626
Sequence CCCTGCCCACTCTGGCCCGGGCC GGCCCTGGCACAGTACCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 48, 4: 482} {0: 1, 1: 0, 2: 4, 3: 19, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!