ID: 968867926_968867934

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 968867926 968867934
Species Human (GRCh38) Human (GRCh38)
Location 4:3225615-3225637 4:3225629-3225651
Sequence CCTGCCCCCCTGTGCAGATCAAG CAGATCAAGACTCAGGGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 162} {0: 1, 1: 0, 2: 0, 3: 14, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!