ID: 968879773_968879797

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 968879773 968879797
Species Human (GRCh38) Human (GRCh38)
Location 4:3292990-3293012 4:3293040-3293062
Sequence CCCCGCCCTCGCCTCGACCCCGG GCGCGCGCGGGCGGTGGCGCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 9, 3: 93, 4: 613}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!