ID: 968883622_968883630

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 968883622 968883630
Species Human (GRCh38) Human (GRCh38)
Location 4:3315228-3315250 4:3315278-3315300
Sequence CCTTTCGCTGTAATGAATCTCAG TGGGAATCCTAGGGAATCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 156} {0: 1, 1: 0, 2: 0, 3: 10, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!