ID: 968883867_968883874

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 968883867 968883874
Species Human (GRCh38) Human (GRCh38)
Location 4:3317069-3317091 4:3317091-3317113
Sequence CCTTCAGCGCCGTGTGCCCGGAC CGACCGGCGATTTTTCGGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 53} {0: 1, 1: 0, 2: 0, 3: 0, 4: 13}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!