ID: 968889999_968890008

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 968889999 968890008
Species Human (GRCh38) Human (GRCh38)
Location 4:3363799-3363821 4:3363832-3363854
Sequence CCCCTGGGACCCAGGGGTCAGGG AGCTTGGTACTAGAAACCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 436} {0: 1, 1: 0, 2: 1, 3: 10, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!