ID: 968900464_968900472

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 968900464 968900472
Species Human (GRCh38) Human (GRCh38)
Location 4:3429106-3429128 4:3429147-3429169
Sequence CCCAGGTGAGGGGAGGTGGAGCA GTGGGCTTGCTGAGCTCTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 380} {0: 1, 1: 0, 2: 2, 3: 24, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!