ID: 968908168_968908180

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 968908168 968908180
Species Human (GRCh38) Human (GRCh38)
Location 4:3463952-3463974 4:3463977-3463999
Sequence CCTGGACCCCTCCCAGGCAGACG AGGCTGGGCTGCGGTAGGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 69, 4: 573}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!