ID: 968911197_968911205

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 968911197 968911205
Species Human (GRCh38) Human (GRCh38)
Location 4:3477755-3477777 4:3477776-3477798
Sequence CCTTGGCCCCTCTGGGATTGGAG AGAGCCAGTATGGATGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 252} {0: 1, 1: 0, 2: 2, 3: 20, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!