ID: 968914769_968914783

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 968914769 968914783
Species Human (GRCh38) Human (GRCh38)
Location 4:3492606-3492628 4:3492627-3492649
Sequence CCAGGTTTCTGCTGTAGGCCCCG CGGGGCTTGGGGGCTGGAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 111} {0: 1, 1: 1, 2: 2, 3: 92, 4: 803}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!