ID: 968916390_968916399

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 968916390 968916399
Species Human (GRCh38) Human (GRCh38)
Location 4:3498713-3498735 4:3498753-3498775
Sequence CCTGCCTGGGCACCAGAACTTGG TCATCTCGATGAAGGGGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 218, 4: 5208} {0: 1, 1: 0, 2: 1, 3: 3, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!