ID: 968961201_968961208

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 968961201 968961208
Species Human (GRCh38) Human (GRCh38)
Location 4:3744542-3744564 4:3744570-3744592
Sequence CCGCCCAGCAGTCCATGGCAGGG CAGGCGCTCCTGCCCAGGACCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 25, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!