ID: 968963716_968963722

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 968963716 968963722
Species Human (GRCh38) Human (GRCh38)
Location 4:3758879-3758901 4:3758892-3758914
Sequence CCCAAGCCAGGTACCCAGGGCTG CCCAGGGCTGCCCAGTGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 271} {0: 1, 1: 1, 2: 10, 3: 149, 4: 781}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!