ID: 968977395_968977402

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 968977395 968977402
Species Human (GRCh38) Human (GRCh38)
Location 4:3829124-3829146 4:3829155-3829177
Sequence CCGGGACAAGCCCAGGAGTCTGC CAGGTCCAGGGAATTGTCAGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 18, 4: 268} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!