ID: 969032594_969032610

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 969032594 969032610
Species Human (GRCh38) Human (GRCh38)
Location 4:4226727-4226749 4:4226763-4226785
Sequence CCGCCGGGGGGCCGGGGATTCCG CGAGGACGAGGGAGGCGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 0, 3: 8, 4: 93} {0: 1, 1: 1, 2: 1, 3: 18, 4: 285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!