ID: 969125787_969125790

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 969125787 969125790
Species Human (GRCh38) Human (GRCh38)
Location 4:4946825-4946847 4:4946844-4946866
Sequence CCATTTGGTCAGGAGGAGAATGG ATGGAGATTCTGAAGCAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 190} {0: 1, 1: 0, 2: 5, 3: 54, 4: 471}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!