ID: 969131606_969131618

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 969131606 969131618
Species Human (GRCh38) Human (GRCh38)
Location 4:4994718-4994740 4:4994769-4994791
Sequence CCTGAGAGGTGACAGCCCAAAAT GACTCAGCTTTTCCTCCAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 237} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!