|
Left Crispr |
Right Crispr |
| Crispr ID |
969151818 |
969151825 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:5176201-5176223
|
4:5176235-5176257
|
| Sequence |
CCCCTTTCTTTGTCTGGGAAAGG |
CCCGTTGCACTTCCCAGGTGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 77, 2: 2871, 3: 1231, 4: 849} |
{0: 2, 1: 375, 2: 1479, 3: 2207, 4: 2263} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|