ID: 969157117_969157125

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 969157117 969157125
Species Human (GRCh38) Human (GRCh38)
Location 4:5220725-5220747 4:5220769-5220791
Sequence CCTTGTTAGCTAGCTCTCCATGG CAGAAAGAACAGAGGCAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 72} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!